$ find . -name ‘*.h’ -o -name ‘*.cpp’ To find this information in the man page, type man find and the search for operators by typing /OPERATORS and hit enter. The . isn’t strictly necessary with GNU find, but is necessary in Unix. The quotes are important in either case, and leaving them out will … Read more
A process group is a collection of related processes which can all be signalled at once. A session is a collection of process groups, which are either attached to a single terminal device (known as the controlling terminal) or not attached to any terminal. Sessions are used for job control: one of the process groups … Read more
If you’re still looking for something robust even in the far future, try https://stackoverflow.com/a/13938099/1601531, where I suggest the use of February 31st in crontab entries which are never intended to execute. 0 0 5 31 2 ?
Tell grep to treat your input as fixed string using -F option. grep -F ‘*^%Q&$*&^@$&*!^@$*&^&^*&^&’ application.log Option -n is required to get the line number, grep -Fn ‘*^%Q&$*&^@$&*!^@$*&^&^*&^&’ application.log
Piping to another process (although this won’t accomplish what you said you are trying to do): command1 | command2 This will send the output of command1 as the input of command2. -exec on a find (this will do what you want to do, but it’s specific to find): find . -name ‘*.foo’ -exec cat {} … Read more
I’d recommend pygmentize from the python package python-pygments. You may want to define the following handy alias (unless you use ccat from the ccrypt package). alias ccat=”pygmentize -g” And if you want line numbers: alias ccat=”pygmentize -g -O style=colorful,linenos=1″ Add one of these above commands to ~/.bash_aliases for permanent effect
If using GNU grep, you can use the Perl-style regexp: grep -P ‘\t’ *
Might not be one that 99% of Vim users don’t know about, but it’s something I use daily and that any Linux+Vim poweruser must know. Basic command, yet extremely useful. :w !sudo tee % I often forget to sudo before editing a file I don’t have write permissions on. When I come to save that … Read more
This awk program: % awk ‘!/^>/ { printf “%s”, $0; n = “\n” } /^>/ { print n $0; n = “” } END { printf “%s”, n } ‘ input.fasta Will yield: >accession1 ATGGCCCATGGGATCCTAGC >accession2 GATATCCATGAAACGGCTTA Explanation: On lines that don’t start with a >, print the line without a line break and store … Read more
Slowly, the Unix world is moving from ASCII and other regional encodings to UTF-8. You need to be running a UTF terminal, such as a modern xterm or putty. In your ~/.bash_profile set you language to be one of the UTF-8 variants. export LANG=C.UTF-8 or export LANG=en_AU.UTF-8 etc.. You should then be able to write … Read more