Remove line breaks in a FASTA file

by

This awk program:

% awk '!/^>/ { printf "%s", $0; n = "\n" } 
/^>/ { print n $0; n = "" }
END { printf "%s", n }
' input.fasta

Will yield:

>accession1
ATGGCCCATGGGATCCTAGC
>accession2
GATATCCATGAAACGGCTTA

Explanation:

On lines that don’t start with a >, print the line without a line break and store a newline character (in variable n) for later.

On lines that do start with a >, print the stored newline character (if any) and the line. Reset n, in case this is the last line.

End with a newline, if required.

Note:

By default, variables are initialized to the empty string. There is no need to explicitly “initialize” a variable in awk, which is what you would do in c and in most other traditional languages.

—6.1.3.1 Using Variables in a Program, The GNU Awk User’s Guide

More Related Contents:

  1. How to delete duplicate lines in a file without sorting it in Unix
  2. Why does my tool output overwrite itself and how do I fix it?
  3. Is there a Unix utility to prepend timestamps to stdin?
  4. sed or awk: delete n lines following a pattern
  5. Print lines in one file matching patterns in another file
  6. Extract specific columns from delimited file using Awk
  7. Explain awk command
  8. Get last field using awk substr
  9. What does the ^M character mean in Vim?
  10. properly join two files based on 2 columns in common
  11. How to remove blank lines from a Unix file
  12. What do ‘real’, ‘user’ and ‘sys’ mean in the output of time(1)?
  13. Identifying and removing null characters in UNIX
  14. Why do shell script comparisons often use x$VAR = xyes?
  15. Why are ports below 1024 privileged? [closed]
  16. What specifically are wall-clock-time, user-cpu-time, and system-cpu-time in UNIX?
  17. What’s the difference between nohup and a daemon?
  18. Remove all text before colon
  19. ‘^M’ character at end of lines
  20. How do I manipulate $PATH elements in shell scripts?
  21. What should we do to prepare for 2038?
  22. How can I send an email through the UNIX mailx command?
  23. Convert decimal to hexadecimal in UNIX shell script
  24. Setting environment variable in shell script does not make it visible to the shell
  25. What generates the “text file busy” message in Unix?
  26. How to remove EXIF data without recompressing the JPEG?
  27. A cron job that will never execute
  28. Grepping for exact words with UNIX
  29. Why does RSA encrypted text give me different results for the same text
  30. How to determine a terminal’s background color?

Leave a Comment