How to find the overlap between 2 sequences, and return it

by

Have a look at the difflib library and more precisely at find_longest_match():

import difflib

def get_overlap(s1, s2):
    s = difflib.SequenceMatcher(None, s1, s2)
    pos_a, pos_b, size = s.find_longest_match(0, len(s1), 0, len(s2)) 
    return s1[pos_a:pos_a+size]

s1 = "CGATTCCAGGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTC"
s2 = "GGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTCGTCCAGACCCCTAGC"

print(get_overlap(s1, s2)) # GGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTC

More Related Contents:

  1. How do i implement these algorithms below
  2. Removing duplicates in lists
  3. How to generate all permutations of a list?
  4. How to efficiently compare two unordered lists (not sets) in Python?
  5. How to split text without spaces into list of words
  6. Approximating data with a multi segment cubic bezier curve and a distance as well as a curvature contraint
  7. Weighted random selection with and without replacement
  8. What is the fastest way to flatten arbitrarily nested lists in Python? [duplicate]
  9. Understanding recursion in Python
  10. Efficient calculation of Fibonacci series
  11. How did Python implement the built-in function pow()?
  12. Find longest repetitive sequence in a string
  13. Python string ‘in’ operator implementation algorithm and time complexity
  14. Algorithm to find which number in a list sum up to a certain number
  15. Checking if all elements in a list are unique
  16. Mapping a range of values to another
  17. When splitting an empty string in Python, why does split() return an empty list while split(‘\n’) returns [”]?
  18. Weighted random sample in python
  19. How to check whether two lists are circularly identical in Python
  20. How to test if one string is a subsequence of another? [duplicate]
  21. Fast prime factorization module
  22. What’s the algorithm of ‘set.intersection()’ in python?
  23. How to incrementally sample without replacement?
  24. Split a list of numbers into n chunks such that the chunks have (close to) equal sums and keep the original order
  25. Replace list of list with “condensed” list of list while maintaining order
  26. Python: Choose random line from file, then delete that line
  27. String similarity metrics in Python [duplicate]
  28. Python Weighted Random [duplicate]
  29. How can I interleave or create unique permutations of two strings (without recursion)
  30. Python: powerset of a given set with generators [duplicate]

Leave a Comment